Skip to main content

TableĀ 1 PCR primers

From: LINC00667/miR-449b-5p/YY1 axis promotes cell proliferation and migration in colorectal cancer

LINC00667 F TGTGCGAGAAAGCCTACCTG
LINC00667 R GCCTGCATCAAAAAGTCGGG
miR-449b-5p F GCCGAGAGGCAGTGTATTGTTA
miR-449b-5p R AGGCAGTGTATTGTTAGCTGGC
YY1 F AAGTGCATTCCACCCGAACT
YY1 R AAGGGCCTGCACTTAAACCA
GAPDH F GGAGCGAGATCCCTCCAAAAT
GAPDH R GGCTGTTGTCATACTTCTCATGG
U6 F CTCGCTTCGGCAGCACA
U6 R AACGCTTCACGAATTTGCGT