Skip to main content

TableĀ 2 Sequence for LINC00667 probe used in FISH assay

From: LINC00667/miR-449b-5p/YY1 axis promotes cell proliferation and migration in colorectal cancer

Gcuugacugucuucaacaaaccaaugccacauuuaaaauguuuaaacauuaaccuucccagucccagguaugaugcuuuguguuacuugugguaucuaucucucucucucucugucaaucacacacacacacacacagccuacagguagguaguccagggcugguauugucauuccacaucuagaauccagcuuucagguccacccuuccuggggagugacucucaucuucauaaucuaaaauggcugcuaggguguuagccaucacauuugcauuccaggcagaaaaaugaagaaaggaaaaagaaggcaaagggcaauguucuuacugucuuuaauaguuuccuaacacugccacagaagauaucugcuuauaucucacugucuaaaguucagucacauggccacaaucucaaggaaggcugggguacuuuaaucuuuauugagggcagucaugugcccagcuaaaaccagggguucuauuacuaagaaagauacagcugccccccaccccaaaacaauucaauaaaaauacaaauaaacaauaguguaguaacuauuuucauagcauuuacacauucauuauuauaaguaauguagagaugauuuaaaguauauggaagaugugcaaagguuauaugcaaauacu guaauauuuuauauaaaugacuugagcaccugcagauuuugguaucccugagaguuccuggaaccaauccccuucagauaccaacgaauaacuguacauguuugguagagaacuaguugucucuaccuagucuccauucuggucacuucuuuaguuuccuaauuucagaguaaggccagucuccuucugugaugguuaauuuugugucaacuugagugaaccaagggaugcccagauaccugguaaaacauuauuuccacguguguuggugaggguguuucuggaagucauugacauuucuacugguagacugaguaaagaagauccacccucacuaauguggaugggcauca