Skip to main content

Table 1 Primer sequences used for qRT-PCR

From: Circ_0000527 promotes the progression of retinoblastoma by regulating miR-646/LRP6 axis

circ_0000527 F: TCAACCAGGTGGATGTGTGG
R: GACTCGCTCGAGAGGGGTTA
miR-646 F: ACACTCCAGCTGGGAAGCAGCTGCCTC
R: CTCAACTGTGCTGCATTAGTTAGCTCAGA
U6 F: CGCTTCGGCAGCACATATACTA
R: CGCTTCACGAATTTGCGTGTCA
LRP6 F: AGG CACTTACTTCCCTGCAA
R: GGGCACAGGTTCTGAATCAT
GAPDH F: CGGATTTGGTCGTATTGGG
R: CTGGAAGATGGTGATGGGATT
  1. F forward, R reverse, RT reverse transcription