Skip to main content

Table 1 sequence of primers and sh RNAs

From: Long non-coding RNA LINC01426 facilitates glioblastoma progression via sponging miR-345-3p and upregulation of VAMP8

Name Sequence (5′–3′)
Linc01426 primer F: CGCACCCAGATACTTTTCGT
R: GCCGTTGAGGTTGTCGTAAT
GAPDH primer F: GTAACCCGTTGAACCCCATT
R: CCATCCAATCGGTAGTAGCG
MiR345-3p primer F: TAGTCCAGGGCTCGTGATGG
R: GGGTCAGAGAGGCTGTCGAT
VAMP8 primer F: AAGACGACATCGCAGAAGGT
R: GACCCTCTTGGCACACATTT
CCND1 F: GCTGCGAAGTGGAAACCATC
R: CCTCCTTCTGCACACATTTGAA
XIAP F: AATAGTGCCACGCAGTCTACA
R: CAGATGGCCTGTCTAAGGCAA
IL6 F: ACTCACCTCTTCAGAACGAATTG
R: CCATCTTTGGAAGGTTCAGGTTG
IL8 F: TTTTGCCAAGGAGTGCTAAAGA
R: AACCCTCTGCACCCAGTTTTC
MMP9 F: GGGACGCAGACATCGTCATC
R: TCGTCATCGTCGAAATGGGC
MMP13 F: TCCTGATGTGGGTGAATACAATG
R: GCCATCGTGAAGTCTGGTAAAAT
U1 primer F: AGCTCATGTGCGTGATCCAG
R: TTACACACACGGTCACTTGC
Sh-#1 AAAAGGTGCTGAACTTTGAAAATTTGGATCCAAATTTTCAAAGTTCAGCACC
Sh-#2 AAAAGGAGACGCTGTTTCACCATTTGGATCCAAATGGTGAAACAGCGTCTCC