Skip to main content

Table 1 Primer sequence information for reverse transcript polymerase chain reaction

From: LncRNA HOTAIR induces sunitinib resistance in renal cancer by acting as a competing endogenous RNA to regulate autophagy of renal cells

Name of primer Sequences
miR-17-5p-F GATGGACGTGACATTCG
miR-17-5p-R GCAGGGTCCGAGGTATTC
U6-F CTCTCGCTTCGGCAGCACA
U6-R ACGCTTCACGAATTTGCGT
HOTAIR-F GGGGAAAATTTGGGAAGGCG
HOTAIR-R TGCAAACCAATCGCCTGAAC
Beclin1-F GTAGACCGGACTTGGGTGAC
Beclin1-R TACCACATGCCTTGGTGACG
GAPDH-F GCAAGGATGCTGGCGTAATG
GAPDH-R TACGCGTAGGGGTTTGACAC
  1. F, forward primer; R, reversed primer