Skip to main content

Table 1 Primer sequences for RT-qPCR

From: RACK1 promotes miR-302b/c/d-3p expression and inhibits CCNO expression to induce cell apoptosis in cervical squamous cell carcinoma

Genes Primer sequences (5′–3′)
RACK1 F: TCTCTTTCCAGCGTGGCCATTAGA
R: CCTCGAAGCTGTAGAGATTCCGACAT
miR-302b-3p F: ATCCAGTGCGTGTCGTG
R: TGCTTAAGTGCTTCCATGTT
miR-302c-3p F: GCGTGCTTCCATGTTTCAGTGG
R: CAGTGCAGGGTCCGAGGTAT
miR-302d-3p F: TCTACTTTAACATGGAGGCACTT
R: TCACCAAAACATGGAAGCAC
CCNO F: TCTACAGACCTTCCGCGACT
R: GCTCTACCAGCACCTCACTT
U6 F: CGCTTCGGCAGCACATATACTA
R: CGCTTCACGAATTTGCGTGTCA
GAPDH F: TCATCTCTGCCCCCTCTGCTG
R: GCCTGCTCACCACCTTCTTG
  1. F, forward; R, reverse; RT-qPCR, reverse transcription quantitative polymerase chain reaction; RACK1, receptor for activated protein kinase C; CCNO, Cyclin O; GAPDH, glyceraldehyde-3-phosphate dehydrogenase