Skip to main content

Table 1 qRT-PCR primer sequence

From: Abnormal expression and prognostic significance of EPB41L1 in kidney renal clear cell carcinoma based on data mining

Primer name Sequence 5′ → 3′
EPB41L1 F: AGGAAACCACGCCGAGACACAA
R: GGTGGATGAGTTTGCTGTTGGG
GAPDH F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG