Skip to main content

Table 1 The primer sequences

From: Long noncoding RNA LINC00261 suppresses prostate cancer tumorigenesis through upregulation of GATA6-mediated DKK3

Name Sequence (5′–3′)
LINC00261 F: GTCAGAAGGAAAGGCCGTGA
R: TGAGCCGAGATGAACA GGTG
GATA6 F: GTGAACTGCGGCTCCATCCA
R: CCTTCCCTTCCATCTTCTCTCA
DKK3 F: GTAAGTTCCCCTCTGGCTTG
R: AAGCACCAGACTGTGAAGCCT
β-actin F: CGCACCACTGGCATTGTCAT
R: TTCTCCTTGATGT-CACGCAC
  1. LINC00261 long non-coding RNA 00261, GATE6 GATA binding protein 6, DKK3 dickkopf-related protein 3, F forward, R reverse