Skip to main content

Table 1 Primer sequences used for RT-qPCR

From: Circ_002117 binds to microRNA-370 and promotes endoplasmic reticulum stress-induced apoptosis in gastric cancer

Targets Forward primer (5′–3′) Reverse primer (5′–3′)
circ_002117 CCGCAGTTCTACTCGGGC GCCCCATGGTGGGAACAG
miR-370 GCATCGTTCCTTCAAGCCGATCT TGGGTGAGTCGTTCGG
HERPUD1 CCGGTTACACACCCTATGGG TGAGGAGCAGCATTCTGATTG
GADPH CATTCAAGACCGGACAGAGG ACATACTCAGCACCAGCATCACC
U6 GTCCTGGCAGATATACACTAAACAT CTCACGCTTGAATTCATGCGGCTT