Skip to main content

Table 1 PCR primers used to validate cell lines

From: Development of syngeneic murine cell lines for use in immunocompetent orthotopic lung cancer models

Target Recombinant PCR-forward Recombinant PCR-reverse Recombinant PCR-reverse 2
p53 CACAAAAACAGGTTAAACCCA GAAGACAGAAAAGGGGAGGG  
Kras GGGTAGGTGTTGGGATAGCTG TCCGAATTCAGTGACTACAGATGTACAGAG  
PTEN ACTCAAGGCAGGGATGAGC AATCTAGGGCCTCTTGTGCC GCTTGATATCGAATTCCTGCAGC
SMAD4 TCCCACATTCCTCTTAGTTTTGA CCAGCTTCTCTGTCCAGGTAGTA  
PIK3CA CACAGCTCGCGGTTGAGG TGCTCGACGTTGTCACTGAA CGGGTGTACTCCTCATATAACA
TGFβR2 AGGGATGAATGGGCTTGCTT CTCACCTCAGAGCCTGATTA  
TAK1 GCAACTTCGACAACTTGCCTTCCTGTG GCACTTGAATTAGCGGCCGCAAGCTTATAACT  
EML-ALK GAGCCTTGTTGATACATCGTTC TAGGAGGCAGTTTGGGCTAC CAAGGCAGTGAGAACCTGAA