Skip to main content

Table 1 siRNAs used to knockdown circ_104889

From: CircRNA_104889 promotes lung adenocarcinoma cell invasion via sponging miR4458

siRNA Nucleotide sequence
miR4458 mimic 5′ UUGUACUACACAAAAGUACUG 3′
siRNA 1 Sense: 5′ UCAUACAGCCCUGUGUGGA 3′
Antisense: 5′ UCCACACAGGGCUGUAUGA 3′
siRNA 2 Sense: 5′ UGUCAUACAGCCCUGUGUG 3′
Antisense: 5′ CACACAGGGCUGUAUGACA 3′
siRNA 3 Sense: 5′ UACAGCCCUGUGUGGAGAG 3′
Antisense: 5′ CUCUCCACACAGGGCUGUA 3′