Skip to main content

Table 2 Primers used for qPCR

From: CircRNA_104889 promotes lung adenocarcinoma cell invasion via sponging miR4458

Gene Primer sequence
GAPDH forward 5′ GCACCGTCAAGGCTGAGAAC 3′
GAPDH reverse 5′ TGGTGAAGACGCCAGTGGA3′
circRNA_104889 forward 5′ AATGTCACTCAGACTTGCTTTG 3′
circRNA_104889 reverse 5′ ATGCCACCCACTTGTTCC 3′
circRNA_103722 forward 5′ TCAGCCACTTGTTCATCTAA 3′
circRNA_103722 reverse 5′ CAGCATTCACTAAGGCATCT 3′
circRNA_101099 forward 5′ CTGGTGATTATGGGAGTGC 3′
circRNA_101099 reverse 5′ TTGGTGCTGCTCCTTTAC 3′
circRNA_102633 forward 5′ AAGGTTTTAGCCCTGAGTC 3′
circRNA_102633 reverse 5′ GCAGCCATAAGGATGAGTT 3′
circRNA_101972 forward 5′ TTCCAAGAAGCCAAAGAC 3′
circRNA_101972 reverse 5′ AAGATTCAAGCGAAAGGTA 3′
circRNA_103064 forward 5′ CGTCCCTCCTACCATAAA 3′
circRNA_103064 reverse 5′ GGTGCTTGGCAATCAGT 3′
circRNA_101996 forward 5′ AGGGTGAGAAGCAGAAAGC 3′
circRNA_101996 reverse 5′ CGTAGGAGTGGGAGTGTTG 3′
circRNA_104736 forward 5′ AGCCCTCAAAAGTTCTCC 3′
circRNA_104736 reverse 5′ GTGATGATTTCCTCTTCTCG 3′
PAPPA forward 5′ AACCCCACACGGGTAGAGA 3′
PAPPA reverse 5′ AGAGCAGGGTGAGGATACCA 3′
Caspase-3 forward 5′ TTCAGAGGGGATCGTTGTAGA 3′
Caspase-3 reverse 5′ AATAACCAGGTGCTGTGGAGTA 3′
miR4458 forward 5′ CGAGAGGTAGGTGTGGAAGAA 3′