Skip to main content

Table 1 The primers and siRNAs used in this study

From: Epigenetic regulation of osteopontin splicing isoform c defines its role as a microenvironmental factor to promote the survival of colon cancer cells from 5-FU treatment

  Target Oligonucleotide sequence
qPCR OPN-t F: GCCGAGGTGATAGTGTGGTT
R: AACGGGGATGGCCTTGTATG
OPN-a F: GCCGAGGTGATAGTGTGGTT
R: AACGGGGATGGCCTTGTATG
OPN-b F: ATCTCCTAGCCCCACAGAC
R: AAAATCAGTGACCAGTTCATCAG
OPN-c F: TGAGGAAAAGCAGAATGCTG
R: GTCAATGGAGTCCTGGCTGT
OPN-exon4 F: AAGATAGCCACACTCAGGCCATTTG
R: CAGCCTCATCTGTGGATGGCTTAAC
OPN-exon5 F: AACAAGAGGTAAGTTCTCATTTTCA
R: AACTTATCCGAGGAAACCTAGTATT
HAUS8 F: ACAGGGTGCCACCTCTTTCT
R: TGCAGGTGCTGGACTTACTG
GAPDH F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
siRNA Scramble Sense: UUCUCCGAACGUGUCACGUTT
Antisense: ACGUGACACGUUCGGAGAATT
MeCP2-1 Sense: GCUUAAGCAAAGGAAAUCUTT
Antisense: AGAUUUCCUUUGCUUAAGCTT
MeCP2-2 Sense: GCUUCCCGAUUAACUGAAATT
Antisense: UUUCAGUUAAUCGGGAAGCTT