Skip to main content

Table 1 The primer sequences used for qRT-PCR

From: CircUBE2D2 (hsa_circ_0005728) promotes cell proliferation, metastasis and chemoresistance in triple-negative breast cancer by regulating miR-512-3p/CDCA3 axis

Gene Primer sequences (5′–3′)
circUBE2D2 Forward, GATCACAGTGGTCTCCAGCA
Reverse, GCCCCATTATTGTAGCTTGC
UBE2D2 Forward, AGAATCCACAAGGAATTGAATGAT
Reverse, TGGACAAGAGTACTTTTGAAATAG
miR-512-3p Forward, AAGUGCUGUCAUAGCUGAGGUC
Reverse, UUCUCCGAACGUGUCACGUTT
CDCA3 Forward, TGGTATTGCACGGACACCTA
Reverse, TGTTTCACCAGTGGGCTTG
GAPDH Forward, AGCCACATCGCTCAGACAC
Reverse, GCCCAATACGACCAAATCC
U6 Forward, CTCGCTTCGGCAGCACA
Reverse, AACGCTTCACGAATTTGCGT