Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Overexpression of microRNA-367 inhibits angiogenesis in ovarian cancer by downregulating the expression of LPA1

Gene Forward primer (5′-3′) Reverse primer (5′-3′)
miR-367 ACTGCAAGAAACGGTTTTCCC GGCGCGGAACACTGAGATGT
LPA1 ATCTTTGGCTATGTTCGCCA TTGCTGTGAACTCCAGCCA
MCM2 CACATCGAGTCCATGATCC CAAAAGTCTTGCGCATGCT
MMP2 TTTGCTCGGGCCTTAAAAGTAT CCATCAAACGGGTATCCATCTC
MMP9 CGGACCCGAAGCGGACAT GGGGCACCATTTGAGTTT
VEGF CATGAACTTTCTGCTGTCTTGG CCTGGTGAGAGATCTGGTTCC
GADPH ACCACAGTCCATGCCATCAC TTACCACCCTGTTGCTGTA
U6 GCTTCGGCAGCACATATACTAAAA CGCTTCACGAATTTGCGTGTCAT
  1. RT-qPCR reverse transcription quantitative polymerase chain reaction, miR-367 microRNA-367, LPA1 lysophosphatidic acid receptor-1, MCM2 minichromosome maintenance 2, MMP2 matrix metalloproteinase 2, MMP9 matrix metalloproteinase 9, VEGF vascular endothelial growth factor, GAPDH glyceraldehyde-3-phosphate dehydrogenase