Skip to main content

Table 1 The primer sequences of RT-qPCR

From: miR-21 regulates immunosuppression mediated by myeloid-derived suppressor cells by impairing RUNX1-YAP interaction in lung cancer

Gene Primer sequences
miR-21 (hsa) F: GGACTAGCTTATCAGACTG
R: CATCAGATG CGTTGCGTA
miR-21 (mus) F: GACATCGCATGGCTGTACCA
R: CCATGAGATTCAACAGTCAACATC
RUNX1 F: TGATGGCTGGCAATGATGAA
R: TGCGGTGGGTTTGTGAAGAC
YAP F: CGCTCTTCAACGCCGTCA
R: AGTACTGGCCTGTCGGGAGT
ARG-1 F: CTCCAAGCCAAAGTCCTTAGAG
R: AGGAGCTGTCATTAGGGACATC
iNOS F: CCAAGCCCTCACCTACTTCC
R: CTCTGAGGGCTGACACAAGG
GAPDH F: TGAAGCAGGCATCTGAGGG
R: CGAAGGTGGAAGAGTGGGAG
U6 F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
  1. RT-qPCR, reverse transcription quantitative polymerase chain reaction; RUNX1, runt-related transcription factor 1; YAP, yes-associated protein; ARG-1, Arginase-1; iNOS, inducible nitricoxide synthase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward ,R, reverse