Skip to main content

Table 1 The primers used in the quantitative real-time PCR assay

From: The novel circ_0028171/miR-218-5p/IKBKB axis promotes osteosarcoma cancer progression

Name Sequence (5′ →  3′)
circRNA_0028171
 Forward CAGGGCAGGGACAGGAAG
 Reverse GAGACAGGCAAGAGGACAAGG
GAPDH
 Forward TGTGGGCATCAATGGATTTGG
 Reverse ACACCATGTATTCCGGGTCAAT
IKBKB
 Forward GGAAGTACCTGAACCAGTTTGAG
 Reverse GCAGGACGATGTTTTCTGGCT
U6
 Forward CTCGCTTCGGCAGCACA
 RT GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACAAAATATGGAAC
miR-218-5p
 Forward GGGGGTTGTGCTTGATCTAAC
 RT GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACACATGGT
miR-1273e
 Forward ACACTCCAGCTGGGTTGCTTGAACCCAGGA
 RT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCCACTTC
miR-583-5p
 Forward GGTGCTCTATGGTAATCTAGCTG
 RT GTTCAGCCTAGTGCAGGGTCAGAGGTGCAGAGGAGACGACTTATACA
miR-3919
 Forward GGTAGAGTTCTCTCAGTAGTAAC
 RT GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACAGGGATT
miR-6835-5p
 Forward AGTCGAAGTCGAAGCTGTCATCG
 RT GGTCAGGTCAACTTGCACCTGCAAACTGTGGTAGGCTTAACCGTCATC
miR-6748-5p
 Forward ATCGGATCAATGCTTAGCTAGAG
 RT GGCCTAAATGTAACATGCTAGCTAGTTGGATAAATGGTCCGATCGATC