Skip to main content

Table 1 Primer sequences used for RT-PCR

From: Interleukin-35 promotes progression of prostate cancer and inhibits anti-tumour immunity

Genes Forward sequence Reverse sequence
EBI3 GATCCGTTACAAGCGTCAGG CTCAGTTCCCCGTAGTCT
p35 CTCCCTTGAAGAACCGGAT ATCAATAGTCACTGCCCGAA
p40 CCCTGACATTCTGCGTTCA AGGTCTTGTCCGTGAAGACTCTA
p28 CAGACGGCAGGCGACCTT TGACTGTGAACTCCCTCCGC