Skip to main content

Table 3 Real-time PCR primers description

From: CD137 agonist induces gastric cancer cell apoptosis by enhancing the functions of CD8+ T cells via NF-κB signaling

Gene Primer sequence
Forward (5′-3′) Reverse (5′-3′)
β-actin TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGAAGCA
IL-10 GACTTTAAGGGTTACCTGGGTTG TCACATGCGCCTTGATGTCTG
TGF-β ACTTGCACCACCTTGGACTTC GGTCATCACCGTTGGCTCA
IFN-γ TCGGTAACTGACTTGAATGTCCA TCGCTTCCCTGTTTTAGCTGC
Perforin CGCCTACCTCAGGCTTATCTC CCTCGACAGTCAGGCAGTC
Granzyme B TGGGGGACCCAGAGATTAAAA TTTCGTCCATAGGAGACAATGC