Skip to main content

Table 2 The primer sequences for RT-qPCR

From: Circ0120816 acts as an oncogene of esophageal squamous cell carcinoma by inhibiting miR-1305 and releasing TXNRD1

Name Primer sequences (5′-3′)
Circ_0120816
 Forward AGCCAGAGTCTGTCGTGAAC
 Reverse TCCCACACCAGCAGAATCAT
Circ_0139153
 Forward TGGGATTTTGCCTTTTGGTA
 Reverse CAGTGAATGGAATGCACCAG
Circ_0096710
 Forward AGCAACATTTGGGGTTCATC
 Reverse GTTCGGCACATGGGTAAAAG
Circ_0095414
 Forward TTATGATCACCCAGGGAGGA
 Reverse CTCCATTTCCACCTCCAGAA
Circ_0085539
 Forward TAGATCCTGCCCTGTTTGCT
 Reverse CCACAGTGACAGCAGGACTC
miR-1305
 Forward ACAGGCCGGGACAAGTGCAATA
 Reverse GCTGTCAACGATACGCTACGTAACG
U6
 Forward CTCGCTTCGGCAGCACA
 Reverse AACGCTTCACGAATTTGCGT
TXNRD1
 Forward AAATTCTTAGGACGGTCGGG
 Reverse AGTCTGCCCTCCTGATAAGC
GAPDH
 Forward GTCAAGGCTGAGAACGGGAA
 Reverse AAATGAGCCCCAGCCTTCTC