Skip to main content

Table 1 Primers used for real-time PCR

From: LINC00665 enhances tumorigenicity of endometrial carcinoma by interacting with high mobility group AT-hook 1

Genes Forward (5′–3′) Reverse (5′–3′)
GAPDH CAAGGTCATCCATGACAACTTTG GTCCACCACCCTGTTGCTGTAG
HMGA1 GAAGGTGAAGGTCGGAGTC GAAGATGGTGATGGGATTTC
LINC00665 GGTGCAAAGTGGGAAGTGTG CGGTGGACGGATGAGAAACG