Skip to main content

Table 2 Primer sequences for RT-qPCR

From: LncRNA HOXA-AS2 promotes glioblastoma carcinogenesis by targeting miR-885-5p/RBBP4 axis

Gene name Primer-F (5′–3′) Primer-R (5′–3′)
HOXA-AS2 AACCCATCTTTGCCTTCTGC CGGAGGAGTTTGGAGTTGG
miR-885-5p GTCCATTACACTACCCTGCCTC CGCGAGCACAGAATTAATACG
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
RBBP4 GTAGAGAGCTCTTCAGCAAGAC AGGAACAGCTGGAGGAAATG
GAPDH GGGAGCCAAAAGGGTCAT GAGTCCTTCCACGATACCAA