Skip to main content

Table 1 RT-qPCR primers

From: LncRNA PCAT6 regulates the progression of pituitary adenomas by regulating the miR-139-3p/BRD4 axis

Target gene Forward primers, 5′–3′ Reverse primers, 5′–3′
Human miR-137
Human miR-139-3p
Rat miR-139-3p
ACGCGTAGTCGAGGAGAGTA
GCCCTGTTGGAGTGTCGTAT
GCCCTGTTGGAGGTCGTATC
CGGCAATTGCACTGGATACG
GTATCCAGTGCGTGTCGTGG
GTATCCAGTGCGTGTCGTGG
Human miR-31
Human miR-507
GACGATCTCCTCAGCACCTG
GAAGTGCCATGCATGTGTCT
CGGCAATTGCACTGGATACG
CGGCAATTGCACTGGATACG
Human miR-542-3p
Human miR-571
AAGTCGTATCCAGTGCAATTGC
GGCTCTTGAGTTGGCCATCT
GTCGTATCCAGTGCGTGTCG
CGGCAATTGCACTGGATACG
Human miR-578
Human miR-580
Human miR-617
Human miR-658
Human PCAT6
Human BRD4
Rat BRD4
Human U6
Rat U6
Human GAPDH
Rat GAPDH
TCCCGGACAACAAGAAGCTC
GGTTCCGGTCAGAAATTGTCG
GTGGCCATTTCCTACCACCT
GGAAGTAGGTCCGTTGGTCG
CAGGAACCCCCTCCTTACTC
ACCTCCAACCCTAACAAGCC
CCTCCCAAATGTCTACAACGC
CTCGCTTCGGCAGCACA
GACCTCTATGCCAACACAGT
GGAGCGAGATCCCTCCAAAAT
AGGTCGGTGTG AACGGATTTG
CGGCAATTGCACTGGATACG
TGTCGTGGAGTCGGCAATTG
CGGCAATTGCACTGGATACG
CGGCAATTGCACTGGATACG
CTAGGGATGTGTCCGAAGGA
TTTCCATAGTGTCTTGAGCACC
TGAGCAGATATTGCAGTTGGTT
AACGCTTCACGAATTTGCGT
AGTACTTGCGCTCAGGAGGA
GGCTGTTGTCATACTTCTCATGG
TGTAGACCATGTAGTTGAGGTCA