Skip to main content

Table 1 PCR primer sequences

From: Downregulation of tumor‐derived exosomal miR-34c induces cancer‐associated fibroblast activation to promote cholangiocarcinoma progress

IL-1B Forward Sequence CCACAGACCTTCCAGGAGAATG
Reverse Sequence GTGCAGTTCAGTGATCGTACAGG
IL-6 Forward Sequence AGACAGCCACTCACCTCTTCAG
Reverse Sequence TTCTGCCAGTGCCTCTTTGCTG
IL-8 Forward Sequence GAGAGTGATTGAGAGTGGACCAC
Reverse Sequence CACAACCCTCTGCACCCAGTTT
miR-34c Forward Sequence GGCAGTGTAGTTAGCTG
Reverse Sequence GAACATGTCTGCGTATCTC
WNT1 Forward Sequence CTCTTCGGCAAGATCGTCAACC
Reverse Sequence CGATGGAACCTTCTGAGCAGGA
β-actin Forward Sequence CACCATTGGCAATGAGCGGTTC
Reverse Sequence AGGTCTTTGCGGATGTCCACGT
18 s rRNA Forward Sequence ACCCGTTGAACCCCATTCGTGA
Reverse Sequence GCCTCACTAAACCATCCAATCGG