Skip to main content

Table 1 Information of primers used for real-time polymerase chain reaction

From: Circ-CCDC66 upregulates REXO1 expression to aggravate cervical cancer progression via restraining miR-452-5p

Primer Sequence (5′ to 3′)
CCDC66 ACCTACAACCGGAAGCCAG
AGCAGTACTGTTTCCTGATGC
miR-452-5p AAGAGGGCATGGAAACACTG
ACTCACCCCATTCTTCAAGG
REXO1 GTATGACCCTCTGTCCAACTTCTCT
CATCATCATCTGAGTCTGAGAACCT
GAPDH GGTCTCCTCTGACTTCAACA
GTGAGGGTCTCTCTCTTCCT
U6 GCTTCGGCAGCACATATACTAAAAT
CGCTTCACGAATTTGCGTGTCAT