Skip to main content

Table 4 Primers sequences for qRT-PCR

From: Identification of a potentially functional circRNA–miRNA–mRNA regulatory network for investigating pathogenesis and providing possible biomarkers of bladder cancer

Gene IDPrimer sequences
ForwardReverse
Beta-actinAGCGAGCATCCCCCAAAGTTGGGCACGAAGGCTCATCATT
hsa_circ_0011385TCATTGTTGTCAATCTGGCTCCAGTGCTGTTTGGGGACC
U6AAAGCAAATCATCGGACGACCGTACAACACATTGTTTCCTCGGA
mir-211-5pCGCGTCCGCTTCCTACTGTTAGTGCAGGGTCCGAGGTATT
mir-204-5pGCGCGTCCGTATCCTACTGTTAGTGCAGGGTCCGAGGTATT
mir-182-5pCGCGTCACACTCAAGATGGTAAAGTGCAGGGTCCGAGGTATT
mir-96-5pCGCGTCGTTTTTACACGATCAAGTGCAGGGTCCGAGGTATT