Skip to main content

Table 1 Primer sequences for real-time PCR

From: Three novel circRNAs upregulated in tissue and plasma from hepatocellular carcinoma patients and their regulatory network

Gene Forward primer Reverse primer
hsa_circ_0009910
(divergent)
GTGAGAGGCATCAGTGAGGT CGAGAGAAGAGCAGGGACAT
hsa_circ_0009910
(convergent)
GGACCCCGTTACCACAGAAG CCACTTTCATGTGCCTCCGA
hsa_circ_0089172
(divergent)
AAGAATAACCCTGCAACCCCTT GACAGATGACGTTGAGCTGACT
hsa_circ_0089172
(convergent)
GCCTGTCTCGATCAGCCTTT CTGAACCACTGCCTCGTCAT
β-actin GAGAAATCTGGCACCACACC GGATAGCACAGCCTGGATAGCAA