Skip to main content

Table 1 shRNA sequences used in plasmid construction

From: The lncRNA NEAT1 promotes the epithelial-mesenchymal transition and metastasis of osteosarcoma cells by sponging miR-483 to upregulate STAT3 expression

shRNA name Sequence (5′-3′)
shNEAT1 CCGGTGGCTAGCTCAGGGCTTCAGCTCGAGCTGAAGCCCTGAGCTAGCCATTTTTG
shNC CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG