Skip to main content

Table 2 The primers used in quantitative real-time PCR

From: The lncRNA NEAT1 promotes the epithelial-mesenchymal transition and metastasis of osteosarcoma cells by sponging miR-483 to upregulate STAT3 expression

Primer name Sequence (5′-3′)
Human NEAT1 forward GUCUGUGUGGAAGGAGGAATT
Human NEAT1 reverse UUCCUCCUUCCACACAGACTT
Human miR-483 forward GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGACG
Human miR-483 reverse GGCTCACTCCTCTCCTCC
Human STAT3 forward CAGCAGCTTGACACACGGTA
Human STAT3 reverse AAACACCAAAGTGGCATGTGA
Mouse NEAT1 forward GGGGCCACATTAATCACAAC
Mouse NEAT1 reverse CAGGGTGTCCTCCACCTTTA
Mouse miR-483 forward GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAAGACGG
Mouse miR-483 reverse AATTTCACTCCTCCCCTCC
Mouse STAT3 forward TGGTGTCCAGTTTACCACGA
Mouse STAT3 reverse CCCACATCTCTGCTCCCTAA
Human E-cadherin forward CGAGAGCTACACGTTCACGG
Human E-cadherin reverse GGGTGTCGAGGGAAAAATAGG
Human N-cadherin forward TTTGATGGAGGTCTCCTAACACC
Human N-cadherin reverse ACGTTTAACACGTTGGAAATGTG
Human Vimentin forward GACGCCATCAACACCGAGTT
Human Vimentin reverse CTTTGTCGTTGGTTAGCTGGT
Human Snail forward TCGGAAGCCTAACTACAGCGA
Human Snail reverse AGATGAGCATTGGCAGCGAG
Human GAPDH forward GGACACAATGGATTGCAAGG
Human GAPDH reverse TAACCACTGCTCCACTCTGG
Human U6 forward CTCGCTTCGGCAGCACA
Human U6 reverse AACGCTTCACGAATTTGCGT
Mouse GAPDH forward AGCCCAAGATGCCCTTCAGT
Mouse GAPDH reverse AGCCCAAGATGCCCTTCAGT
Mouse U6 forward GCTTCGGCAGCACATATACTAAAAT
Mouse U6 reverse CGCTTCACGAATTTGCGTGTCAT