Skip to main content

Table 1 Primer sequences for RT-qPCR

From: MicroRNA-1182 and let-7a exert synergistic inhibition on invasion, migration and autophagy of cholangiocarcinoma cells through down-regulation of NUAK1

Gene Sequence (5′-3′)
miR-1182 F: GGGGAGGGTCTTGGGAGGGA
R: GTGCAGGGTCCGAGGT
miR-let-7a F: TGAGGTAGTAGGTTGTGTGGTT
R: GTGCAGGGTCCGAGGT
NUAK1 F: GAAGTTATGCTTTATTCAC
R: CATCCTCTGATTCTAGGTG
MMP-2 F: AGTTTCCATTCCGCTTCCAG
R: CGGTGGTAGTCCTCAGTGGT
MMP-9 F: ACTACTGTGCCTTTGAGTCC
R: AGAATCGCCAGTACTTCCCA
Beclin1 F: ATGCAGGTGAGCTTCGTGTG
R: CTGGGCTGTGCTAAGTAATGCA
LC3 F; AATCCCGGTGATCATCGAGC
R: GCCGGATGATCTTGACCAAC
U6 F: ATTGGAACGATACAGAGAAGATT
R: GGAACGCTTCACGAATTTG
GAPDH F: GGGAAACTGTGGCGTGAT
R: GAGTGGGTGTCGCTGTTGA
  1. RT-qPCR reverse transcription quantitative polymerase chain reaction, MiR-1182 microRNA-1182, miR-let-7a microRNA-let-7a, NUAK1 Novel (nua) kinase family 1, MMP-2 matrix metalloproteinase-2, MMP-9 matrix metalloproteinase-9, LC3 light chain 3, GAPDH glyceraldehyde-3-phosphate dehydrogenase