Skip to main content

Table 1 Primer sequences for quantitative reverse transcription polymerase chain reaction

From: Long non-coding RNA LINC00470 in serum derived exosome: a critical regulator for proliferation and autophagy in glioma cells

Name of primer Sequences
miR-580-3p-F GACTATCGGGACATGTTA
miR-580-3p-R GCAGGGTCCGAGGTATTC
U6-F CTCTCGCTTCGGCAGCACA
U6-R ACGCTTCACGAATTTGCGT
LINC00470-F TTGGCAGCTGCTCTACAGTC
LINC00470-R TGAAAATCCAGCCAGGGGTC
WEE1-F TAGGTAAGGAGGCCTGTCCC
WEE1-R TTTGAACACACGCAACGCAT
GAPDH-F GCAAGGATGCTGGCGTAATG
GAPDH-R TACGCGTAGGGGTTTGACAC
  1. F, forward; R, reverse
\