Skip to main content

Table 1 The primer sequence

From: The VIM-AS1/miR-655/ZEB1 axis modulates bladder cancer cell metastasis by regulating epithelial–mesenchymal transition

Name Forward Reverse
RT-PCR
VIM-AS1
CTCAGACCTGTAGCATCAGCATCAC TTCATTTCCTCATAAGCGAACACTC
RT-PCR
ZEB1
AGCAGTGAAAGAGAAGGGAATGC GGTCCTCTTCAGGTGCCTCAG
RT-PCR
Vimentin
AGTCCACTGAGTACCGGAGAC CATTTCACGCATCTGGCGTTC
RT-PCR
GAPDH
ACAGCCTCAAGATCATCAGC GGTCATGAGTCCTTCCACGAT
RT-PCR
miR-655-3p
RT:GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAAAGAG
F: GCCGCATAATACATGGTTAAC
CAGTGCGTGTCGTGGA
RT-PCR
U6
CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
NC mimics UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
NC inhibitor CAGUACUUUUGUGUAGUACAA  
MiR-655 mimics AUAAUACAUGGUUAACCUCUUU AGAGGUUAACCAUGUAUUAUUU
MiR-655 inhibitor AAAGAGGUUAACCAUGUAUUAU  
Si-VIM-AS1 1# GGAUGUGUAAGAGAAUUUATT UAAAUUCUCUUACACAUCCTT
Si-VIM-AS1 2# CCAUGUGUGCGAUUCACAATT UUGUGAAUCGCACACAUGGTT
Si-ZEB1 CCUAGUCAGCCACCUUUAATT UUAAAGGUGGCUGACUAGGTT
Si-NC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
Wt-VIM-AS1 aattctaggcgatcgctcgagAGATTTTAAAATAGAGCATGCTTAATATACTT attttattgcggccagcggccgcCACTAGTACACCCCCGACGTG
Mut-VIM-AS1 AGTAtgcgctGTATTGGCTGTCCCACATTTTGA GCCAATACagcgcaTACTACTAAGTAATAAATCTATGTCATCCAAAGG
Wt-ZEB1 3′UTR aattctaggcgatcgctcgagATTTGGCTCATAACTGTTTCCAAA attttattgcggccagcggccgcTTTCATACTAAAATATATTATTGTATTAATACAAACTAC
Mut-ZEB1 3′UTR AgcgcgcaTACCCTTCTTACTGACATATGTACTTTTAGTT AGAAGGGTAtgcgcgcTGCCAGGTTTGAAGACATACAGTAC
Lv-VIM-AS1
overexpression
ctaccggactcagatctcgagTTCTCCCGGAGGCGCATG gtaccgtcgactgcagaattcTTTTTTTTTAGCATATCCAAAAATGG
Lv-miR-655-3p
overexpression
ctaccggactcagatctcgagATATTTTTAATGGAACCTGCCTTAGA gtaccgtcgactgcagaattcACAGCAAACACAGCAAAGCAAC
ZEB1 overexpression ctaccggactcagatctcgagATGAAAGTTACAAATTATAATAC gtaccgtcgactgcagaattcTTAGGCTTCATTTGTCTTTTC