Skip to main content

Table 1 Identities of circRNAs in the prognostic signature and univariable cox association with prognosis

From: RNA sequencing reveals the expression profiles of circRNA and identifies a four-circRNA signature acts as a prognostic marker in esophageal squamous cell carcinoma

Database ID Parent gene Coefficient P Expression with poor prognosis Chromosome circRNA type FISH Probe
hsa_circ_0008199 ATXN10 − 1.181 0.001 Low chr22:46085591-46136418 Exon CTGGGTGCTGTTTCTCTTGTCTTGGT
hsa_circ_0007541 USP13 0.742 0.024 High chr3:179481789-179483636 Intron CGGCTCAGCAAAATTTCCAGATCCAT
hsa_circ_0000005 CDK11A 0.916 0.004 High chr1:1586822-1650894 Exon CATCTTCTTCTCCTCTGTCTTCCATA
hsa_circ_0077536 ATG5 1.065 0.001 High chr6:106727535-106756366 Exon CTTGGCAAAAGCAACATTTTGCAATC
  1. FISH: RNA Fluorescence in situ hybridization
\