Skip to main content

Table 2 Primer sequences for five hub genes and β-actin

From: An epithelial-mesenchymal transition-related 5-gene signature predicting the prognosis of hepatocellular carcinoma patients

Gene Primer sequence
PDCD6 Forward: ATGGCCGCCTACTCTTACC
Reverse: TCCTGTCTTTATCGACCCTCTG
TCOF1 Forward: AGTCTCCAGCAAGAAAGGCG
Reverse: TCCTCTTCTGGCTTCTTGGC
TRIM28 Forward: TGTTTCCACCTGGACTGTCA
Reverse: CCAGCAGTACACGCTCACAT
EZH2 Forward: TGCAGTTGCTTCAGTACCCATAAT
Reverse: ATCCCCGTGTACTTTCCCATCATAAT
FAM83D Forward: AGAGCGGCAATTCCACTTCG
Reverse: TGCCAGAATGAAGGCCAAGG
β-actin Forward: CATGTACGTTGCTATCCAGGC
Reverse: CTCCTTAATGTCACGCACGAT
\