Skip to main content

Table 1 Primers for real-time PCR

From: Macrophages-derived exosomal lncRNA LIFR-AS1 promotes osteosarcoma cell progression via miR-29a/NFIA axis

Primers   Sequences (5′–3′)
LIFR-AS1 F GCAAATACTGTGTATTAGTCC
R CCGCTTCCTTGTGAAGAAGGT
NFIA F TAATCCAGGGCTCTGTGTCC
R CCTGCAGCTATTGGTGTCTG
β‐actin F GTCAGGTCATCACTATCGGCAAT
R AGAGGTCTTTACGGATGTCAACGT
miR-29a F 5′-GGGTAGCACCATCTGAAAT-3’
R CAGTGCGTGTCGTGGAGT
U6 F CTCGCTTCGGCAGCACA
R AACGCTTCACGAATTTGCGT