Skip to main content

Table 2 Sequences of siRNA, shRNA and oligonucleotides used in this research

From: Circular RNA circHECTD1 prevents Diosbulbin-B-sensitivity via miR-137/PBX3 axis in gastric cancer

Gene siRNA Sequence (5’-3’)
si-circHECTD1 CGGTTGTACGCAAGGTTGATC
si-NC
 Sense GAUUGUUCUGAGAGACGAAGA
 Antisense UUCGUCUCUCAGAACAAUCUG
si-PBX3
 Sense UUCUUCGAACGUGUCACGUTT
 Antisense ACGUGACACGUUCGGAGAATT
anti-miR-137 CUACGCGUAUUCUUAAGCAAUAA
anti-miR-NC GGUUCGUACGUACACUGUUCA
miR-137 UUAUUGCUUAAGAAUACGCGUAG
miR-NC GGUUCGUACGUACACUGUUCA
sh-circHECTD1
 Sense GATCCGCACGGTTGTACGCAAGGTTGTTCAAGAGACAACCTTGCGTACAACCGTGTTTTTTGGAAG
 Antisense AATTCTTCCAAAAAACACGGTTGTACGCAAGGTTGTCTCTTGAACAACCTTGCGTACAACCGTGCG
sh-NC
 Sense CACCGTTCTCCGAACGTGTCACGTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTG
 Antisense GATCCAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGACGTGACACGTTCGGAGAAC