Skip to main content

Table 1 Specific primers sequence

From: circ-PTK2 (hsa_circ_0008305) regulates the pathogenic processes of ovarian cancer via miR-639 and FOXC1 regulatory cascade

Primer name Primer sequence (5ʹ-3ʹ)
hsa_circ_0005265 divergent-F ACGGATGCCAGAACAGAACC
hsa_circ_0005265 divergent-R GTTGCCAGTGAGAGAAATCAGC
hsa_circ_0005265 convergent-F GGCCAAAACTTCAAATCCAA
hsa_circ_0005265 convergent-R GCTGTTCTTGTGGTCCCATT
hsa_circ_0008305 divergent-F CGTCTCTGTGTCAGAAAAGATGT
hsa_circ_0008305 divergent-R AGGTTGGCAAATTGTCTAAATGT
hsa_circ_0008305 convergent-F GGATTCTGTCAAGGCCAAAA
hsa_circ_0008305 convergent-R CAGCTTGAACCAAGAGCACA
hsa_circ_0003171 divergent-F CCTCAGCTAGTGACGTATGGA
hsa_circ_0003171 divergent-R ACTGACGCATTGTTAAGGCT
hsa_circ_0003171 convergent-F TGTACTTCGGACAGCGTGAG
hsa_circ_0003171 convergent-R GTGTGCACAGCTCCATGATT
hsa_circ_0005990 divergent-F AGCAGGATGGTGGGACTCAA
hsa_circ_0005990 divergent-R TCTGGTTCATGGCTGTTAAGGA
hsa_circ_0005990 convergent-F CAGCAACTGCAGATGGAGAA
hsa_circ_0005990 convergent-R TGGATTTTGAGTCCCACCAT
hsa_circ_0037002 divergent-F CAGAAGCCTCATTTGCCTGC
hsa_circ_0037002 divergent-R CTTTAATTTGGCCTGCATTACTGA
hsa_circ_0037002 convergent-F AAGTGAACCTGTCCCCATTG
hsa_circ_0037002 convergent-R TTGTCAGGTTTGTCGAGCTG
GAPDH convergent-F GAGTCAACGGATTTGGTCGT
GAPDH convergent-R GAGTCAACGGATTTGGTCGT
GAPDH divergent-F TCCTCACAGTTGCCATGTAGACCC
GAPDH divergent-R TGCGGGCTCAATTTATAGAAACCGGG
Chd1l-F GACCTGAGTTTGGGTGATG
Chd1l-R CGGATAAGTCGTTCGGTA
E-cadherin-F GAGAAACAGGATGGCTGAAGG
E-cadherin-R TGAGGATGGTGTAAGCGATGG
N-cadherin-F ATGAAAGACCCATCCACGC
N-cadherin-R CCTGCTCACCACCACTAC
Snail-F ACCACTATGCCGCGCTCTT
Snail-R GGTCGTAGGGCTGCTGGAA
Vimentin-F AGTCCACTGAGTACCGGAGAC
Vimentin-R CATTTCACGCATCTGGCGTTC
FOXC1-F TCGGCTTGAACAACTCTCCAG
FOXC1-R ACAGTCGTAGACGAAAGCTCC
hsa-miR-639-RT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGCG
hsa-miR-639-F GCCGAGATCGCTGCGGTTGCGAG
Universe R GTGCAGGGTCCGAGGT
hsa-U6-F CTCGCTTCGGCAGCACA
hsa-U6-R AACGCTTCACGAATTTGCGT