Skip to main content

Table 2 The specific interference fragment sequence

From: circ-PTK2 (hsa_circ_0008305) regulates the pathogenic processes of ovarian cancer via miR-639 and FOXC1 regulatory cascade

Name Sequence (5ʹ-3ʹ)
CHD1L-1 sense UAUUGGACAUGCCACGAAA
CHD1L-1 anUisense UUUCGUGGCAUGUCCAAUA
CHD1L-2 sense GGAGACUCAUAGAGGAGAA
CHD1L-2 anUisense UUCUCCUCUAUGAGUCUCC
circ-PUK2 sense GUCAGAAAAGAUGUUGGUUUA
circ-PUK2 anUisense UAAACCAACAUCUUUUCUGAC
si-NC sense UUCUCCGAACGUGUCACGU
si-NC anUisense ACGUGACACGUUCGGAGAA
miR-639 mimics sense AUCGCUGCGGUUGCGAGCGCUGU
miR-639 mimics anUisense ACAGCGCUCGCAACCGCAGCGAU
miR-639 inhibiUor ACAGCGCUCGCAACCGCAGCGAU
inhibiUor NC CAGUACUUUUGUGUAGUACAA