Skip to main content

Table 1 The primer sequences of JAG2, INHBA and β-actin

From: An immune-related model based on INHBA, JAG2 and CCL19 to predict the prognoses of colon cancer patients

JAG2 F primer (5ʹ-3ʹ) CCCTCCTCGTGAAAGTGCAT
R primer (5ʹ-3ʹ) ATACAAAAGGGACAGCACCGAA
INHBA F primer (5ʹ-3ʹ) ACAGGCACTTTCCTACCCAA
R primer (5ʹ-3ʹ) GCACACGATTGTTCTTTTACCAGT
β-actin F primer (5ʹ-3ʹ) AAACGTGCTGCTGACCGAG
R primer (5ʹ-3ʹ) TAGCACAGCCTGGATAGCAAC
  1. F primer forward primer, R primer reverse primer