Skip to main content

Table 1 Gene primer sequences

From: Exosomal circRNA as a novel potential therapeutic target for multiple myeloma-related myocardial damage

Gene Forward Reverse
circ-G024080 AGGGAGGAGGCTGTTAGAGG CTTCCTCACTCCAGCCAGTG
hsa-mir-4268 GGCTCCTCCTCTCAGGAT GGTCCAGTTTTTTTTTTTTTTTCCACA
TLR4 TCCAGAGCCGTTGGTGTATC AGAAGATGTGCCTCCCCAGA
LC3 TTCCTCCTGGTGAATGGGCA TTGCCTTGGTAGGGGCTTAAC
GAPDH GGCCTCCAAGGAGTAAGACC AGGGGAGATTCAGTGTGGTG