Skip to main content

Table 1 Primer sequence for qRT-PCR

From: Downregulation of Tim-1 inhibits the proliferation, migration and invasion of glioblastoma cells via the miR-133a/TGFBR1 axis and the restriction of Wnt/β-catenin pathway

Primer Sequence (5'->3')
miR-133a Forward primer: ACACTCCAGCTGGGTTTGTCCCCTTCAAC
Reverse primer: TGGTGTCGTGGAGTCG
U6 Forward primer: CTCGCTTCGGCAGCACA
Reverse primer: AACGCTTCACGAATTTGCGT
Tim-1 Forward primer: TACCCTGTATCAGGACCAGGA
Reverse primer: GAGAGCTCTGTGCCTTCCAA
TGFBR1 Forward primer: GCAGAGCTGAGCCTTGAGAG
Reverse primer: TGCCCTGTTGACTGAGTTGTG
GAPDH Forward primer: CACCATCTTCCAGGAGCGAG
Reverse primer: AAATGAGCCCCAGCCTTCTC