Skip to main content

Table 1 siRNA and primer sequences

From: Identification and validation of lncRNAs involved in m6A regulation for patients with ovarian cancer

siRNA Sense (5'-3') Antisense (5'-3')
siRNA-1 GCAGACAAAUGGACAACAUTT AUGUUGUCCAUUUGUCUGCTT
siRNA-2 GCCUUCGCAACUCAUUCAUTT AUGAAUGAGUUGCGAAGGCTT
siRNA-3 CAGGAGCAUUUCCCAACAUTT AUGUUGGGAAAUGCUCCUGTT
siNC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT
Primer F primer (5'-3') R primer (5'-3')
CACNA1G-AS1 TTGTTGGCCGGAGCACTAAT AGTGAAGCAGGAAGGAACCG
GAPDH GTCAACGGATTTGGTCTGTATT AGTCTTCTGGGTGGCAGTGAT