Skip to main content

Table 1 The primers for plasmids

From: miR-198 inhibits the progression of renal cell carcinoma by targeting BIRC5

Name Forward primer Reverse primer
FLAG-BIRC5 cccAAGCTTATGGGTGCCCCGACGTTGC ggGGTACCTCAATCCATGGCAGCCAGCTG
BIRC5-WT gcgcgcGAGCTCGGCCTCTGGCCGGA gcgcgcAAGCTTAAGCCATGTTGTTAA
BIRC5-MUT CAGTGAATGTGTTTAAACCTC AACAACATGAGGTTTAAACACAT