Skip to main content

Table 1 Sequences of the primers utilized for real-time quantitative PCR

From: A novel signature constructed by ferroptosis-associated genes (FAGs) for the prediction of prognosis in bladder urothelial carcinoma (BLCA) and associated with immune infiltration

Name Sequence
CRYAB
 Forward (5′–3′) CCTGAGTCCCTTCTACCTTCG
 Reverse (5′–3′) CACATCTCCCAACACCTTAACTT
TFRC
 Forward (5′–3′) AGGTGTTGGGAGATGTGATTGA
 Reverse (5′–3′) GGATGAAGTAATGGTGAGAGGGT
SQLE
 Forward (5′–3′) GGCATTGCCACTTTCACCTAT
 Reverse (5′–3′) GGCCTGAGAGAATATCCGAGAAG
G6PD
 Forward (5′–3′) CGAGGCCGTCACCAAGAAC
 Reverse (5′–3′) GTAGTGGTCGATGCGGTAGA
GAPDH
 Forward (5′–3′) TGTGGGCATCAATGGATTTGG
 Reverse (5′–3′) ACACCATGTATTCCGGGTCAAT
β-actin
 Forward (5′–3′) CATGTACGTTGCTATCCAGGC
 Reverse (5′–3′) CTCCTTAATGTCACGCACGAT