Skip to main content

Table 1 Sequences of primers used for quantitative real-time PCR analysis

From: Aurora kinase A (AURKA) promotes the progression and imatinib resistance of advanced gastrointestinal stromal tumors

Gene Forward (5′–3′) Reverse (5′–3′)
Homo AURKA TGGGTGGTCAGTACATGCTC TGCATCCGACCTTCAATCATTTC
Homo ACTB AGCGAGCATCCCCCAAAGTT GGGCACGAAGGCTCATCATT