Skip to main content

Table 1 Oligonucleotide sequence of human and mouse RT-qPCR primers

From: NF-kB-dependent activation of STAT3 by H. pylori is suppressed by TFF1

Gene ID Human Forward Primers Human Reverse Primers Size (bp)
IL-6 CCCTGAGAAAGGAGACATGTAA TCTTTTTCAGCCATCTTTGGA 129
VEGF-α CCTCCGAAACCATGAACTTT ATGATTCTGCCCTCCTCCTT 122
IL-17 CTGTGTCACCCCGATTGTC TTGAAGGATGAGGGTTCCTG 115
IL-23 AGAAGCTCTGCACACTGGC CCACACTGGATATGGGGAAC 109
Gene ID Mouse Forward Primers Mouse Reverse Primers  
Il-6 GTTCTCTGGGAAATCGTGGA GGAAGTTTCAGATTGTTTTCTGC 114
Vegf-α GGAGAGCAGAAGTCCCATGA TCGGGGTACTCCTGGAAGAT 150
Il-17 CAGGACGCGCAAACATGA GCAACAGCATCAGAGACACAGAT 57
Il-23 GCACCTGCTTGACTCTGACA ATCCTCTGGCTGGAGGAGTT 115