Fig. 1

Silencing of BCL10 in the cells of PDAC using short hairpin RNA (shRNA). a The shRNA-expression lentiviral vector of BCL10 (Clone ID: TRCN0000359256), specifically targets C-terminal region of BCL10, including Ser231 phosphorylation site (ACGTACTGTTTCACGACAATG). Three PDAC cell lines (PANC-1, AsPC-1, and BxPC-3) were infected with pGIPZ lentivirus (scrambled, Scr) and BCL10 shRNA lentivirus. The protein expression of β-actin and BCL10 was examined by western blot analysis. b Transfection with BCL10 shRNA (shBCL10) significantly decreased the levels of BCL10 in nucleus of three PDAC cell lines. Cells were labeled with anti-BCL10 primary antibody and DyLight 488 conjugated secondary antibody. The distribution of BCL10 was observed by immunofluorescence using confocal microscopy. Nuclei were counterstained with DAPI. Scale bar: 20 μm. c shBCL10 transfected PDAC cells exhibited low proliferative ability. The control, scrambled, and shBCL10 transfected cells from PANC-1, AsPC-1, and BxPC-3 cell lines were plated at 1000 cells/well in 96-well plate respectively. Then, cell proliferation rate was evaluated using a Premixed WST-1 Cell Proliferation Reagent after every 2 days. **p < 0.01; ***p < 0.001. PDAC pancreatic ductal adenocarcinoma