Skip to main content

Table 1 The sequences of all primers

From: MicroRNA-550a-3-5p controls the brain metastasis of lung cancer by directly targeting YAP1

Primer Sequence (5′–3′)
has-miR-550a-3-5p JH:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCTTA
F: GCGCAGTGCCTGAGGGAG
hsa-miR-1226-3p JH:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTAGGG
F: GCCTCACCAGCCCTGTGTT
hsa-miR-3200-5p JH:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCTTG
F: GCGCAATCTGAGAAGGCGCA
hsa-miR-144-3p JH:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGTACA
F: GCGCGCGCTACAGTATAGATGA
hsa-miR-27a-3p JH:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC GCGGAA
F: GCGCGTTCACAGTGGCTAAG
Downstream universal primer R: GTGCAGGGTCCGAGGT
U6 RT:GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATATG
F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT