Skip to main content

Table 1 Detailed primer sequences for real-time RT-PCR

From: Mechanistic study of lncRNA UCA1 promoting growth and cisplatin resistance in lung adenocarcinoma

Gene Primer sequences
Forward Reverse
UCA1 ACGCTAACTGGCACCTTGTT CTCCGGACTGCTTCAAGTGT
β-Actin CCTGGCACCCAGCACAAT GCTGATCCACATCTGCTGGAA
ENO1 ACCCAGTGGCTAGAAGTTCAC CCATGGGCTGTGGGTTCTAA