Skip to main content

Table 1 The primer sequences used for quantitative RT-PCR

From: Dysregulation of the miR-30a/BiP axis by cigarette smoking accelerates oral cancer progression

Gene 5'-3' Sequences
BiP Forward TGACATTGAAGACTTCAAAGCT
  Reverse CTGCTGTATCCTCTTCACCAGT
miR-30a Forward AACATCCTCGACTGGAAG
  Reverse GAACATGTCTGCGTATCTC
VEGF Forward GCCTTGCCTTGCTGCTCTAC
  Reverse TGATTCTGCCCTCCTCCTTCTG
GAPDH Forward CCACATCGCTCAGACACCAT
  Reverse TGACCAGGCGCCCAATA